Application notes

FAQ´s and Trouble shooting

Manuals
- PR02 Strep-tag Manual 0022 (pdf, 1021 KB)
- PR03 Strep-tag purification Protocol 0005 (pdf, 90 KB)
- PR04 Strep-Well Protocol 0003 (pdf, 239 KB)
- PR07 Western blot Protocol 0009 (pdf, 112 KB)
- PR08 PCR cloning with pASK-IBA pPR-IBA and pEXPR-IBA Protocol 0007 (pdf, 102 KB)
- PR09 MATra Manual 0014 (pdf, 210 KB)
- PR10 Spin Column Protocol 0005 (pdf, 320 KB)
- PR12 Reagents compatible with Strep-tag Table 0005 (pdf, 71 KB)
- PR13 OneStrep Manual 0011 (pdf, 448 KB)
- PR14 Mammalian Expression Manual 0008 (pdf, 541 KB)
- PR15 Strep-tag AP Manual 0003 (pdf, 79 KB)
- PR16 Strep-tag HRP Manual 0004 (pdf, 79 KB)
- PR17 IBA-lyse Protocol 0001 (pdf, 94 KB)
- PR21 IBAfect Manual 0006 (pdf, 75 KB)
- PR22 Streptamer Manual 0003 (pdf, 247 KB)
- PR23 Irreversible Biacore Immobilization Protocol 0004 (pdf, 241 KB)
- MagStrep Beads Protocol (pdf, 75 KB)
- PR25 StrepMAB-Classic purification Protocol 0001 (pdf, 84 KB)
- PR26 Stargate Manual 0022 (pdf, 3966 KB)
- PR27 PPI 0002 (pdf, 1226 KB)
- PR28 FasL-Strep 0002 (pdf, 83 KB)
- PR29 FCCS Manual for in vivo Standard Probe (pdf, 88 KB)
- PR30 FCCS Manual for in vitro Standard Probe (pdf, 171 KB)

Newsletters & Flyers
- IBA Protein TAGnologies Newsletter Issue 9 (pdf, 1712 KB)
- StarGate Newsletter Issue 6 (pdf, 648 KB)
- StarGate Newsletter Issue 5 (pdf, 2009 KB)
- IBA Newsletter Issue 4 - MATra Special (pdf, 577 KB)
- Streptamer Flyer (pdf, 510 KB)
- Protein:protein Interaction (PDF, 3 MB)
- FasL-Strep and FasL-Strep Assays for Apoptosis Research (PDF, 259 KB)
- Superflow High capacity Flyer (pdf, 626 KB)
- IBA Protein TAGnologies - Custom Service (pdf, 815 KB)
- RNA & Fluorescent dye (PDF, 40 KB)
- Oligo Catalogue (pdf, 2401 KB)

Price List: Nucleic Acids
Prices for other product lines on request at info@iba-go.com

Order Forms

Software (Cloning / Primer)
Classic cloning:
Download the new version of our free software for the fast design of PCR primers for cloning genes with pASK-IBA and pPR-IBA vectors
StarGate cloning:
Make use of the easy-to-use software, the StarPrimer D´Signer 3.0.0.3, to facilitate the design of primers for the ENTRY cloning step to create the Donor Vector.
The software is also very well suited for the design of primers in combination with a site-directed mutation approach. In this case it is used to design primers for introducing mutations into your gene of interest which then is transferred into a StarGate ENTRY vector to create a Donor Vector carrying the mutated gene of interest.
This software does not only help with the primer design, it will also guide you step by step through the whole PCR process.

Vector MAPS
Classic Vectors:
pASK-IBA (E. coli with Tet promoter)
- pASK-IBA2 map, multiple cloning site (pdf, 87 KB)
- pASK-IBA2C map, multiple cloning site (pdf, 91 KB)
- pASK-IBA3C map, multiple cloning site (pdf, 95 KB)
- pASK-IBA3plus map, multiple cloning site (pdf, 85 KB)
- pASK-IBA4 map, multiple cloning site (pdf, 90 KB)
- pASK-IBA4C map, multiple cloning site (pdf, 90 KB)
- pASK-IBA5C map, multiple cloning site (pdf, 89 KB)
- pASK-IBA5plus map, multiple cloning site (pdf, 90 KB)
- pASK-IBA6 map, multiple cloning site (pdf, 91 KB)
- pASK-IBA6C map, multiple cloning site (pdf, 92 KB)
- pASK-IBA7C map, multiple cloning site (pdf, 89 KB)
- pASK-IBA7plus map, multiple cloning site (pdf, 90 KB)
- pASK-IBA12 map, multiple cloning site (pdf, 92 KB)
- pASK-IBA13plus map, multiple cloning site (pdf, 91 KB)
- pASK-IBA14 map, multiple cloning site (pdf, 90 KB)
- pASK-IBA15plus map, multiple cloning site (pdf, 95 KB)
- pASK-IBA16 map, multiple cloning site (pdf, 97 KB)
- pASK-IBA17plus map, multiple cloning site (pdf, 96 KB)
- pASK-IBA32 map, multiple cloning site (pdf, 92 KB)
- pASK-IBA33plus map, multiple cloning site (pdf, 86 KB)
- pASK-IBA35plus map, multiple cloning site (pdf, 91 KB)
- pASK-IBA37plus map, multiple cloning site (pdf, 92 KB)
- pASK-IBA43plus map, multiple cloning site (pdf, 98 KB)
- pASK-IBA44 map, multiple cloning site (pdf, 99 KB)
- pASK-IBA45plus map, multiple cloning site (pdf, 99 KB)
- pASK-IBA63a-plus map, multiple cloning site (pdf, 82 KB)
- pASK-IBA63b-plus map, multiple cloning site (pdf, 82 KB)
- pASK-IBA63c-plus map, multiple cloning site (pdf, 82 KB)
- pASK-IBA65b-plus map, multiple cloning site (pdf, 79 KB)
pPR-IBA (E. coli with T7 promoter)
pEXPR-IBA (mammalia with CMV promoter)
- pEXPR-IBA3 map, multiple cloning site (pdf, 78 KB)
- pEXPR-IBA5 map, multiple cloning site (pdf, 82 KB)
- pEXPR-IBA7 map, multiple cloning site (pdf, 90 KB)
- pEXPR-IBA13 map, multiple cloning site (pdf, 83 KB)
- pEXPR-IBA15 map, multiple cloning site (pdf, 83 KB)
- pEXPR-IBA17 map, multiple cloning site (pdf, 105 KB)
pKS-ST (yeast with ADH2 promoter)

StarGate Vectors:
StarGate ENTRY Vectors
StarGate Acceptor Vectors:
pASG-IBA Vectors (E. coli with Tet promoter)
- pASG-IBAwt1 data sheet (pdf, 115 KB)
- pASG-IBAwt2 data sheet (pdf, 124 KB)
- pASG-IBA2 data sheet (pdf, 129 KB)
- pASG-IBA3 data sheet (pdf, 123 KB)
- pASG-IBA4 data sheet (pdf, 129 KB)
- pASG-IBA5 data sheet (pdf, 126 KB)
- pASG-IBA23 data sheet (pdf, 228 KB)
- pASG-IBA25 data sheet (pdf, 226 KB)
- pASG-IBA33 data sheet (pdf, 120 KB)
- pASG-IBA35 data sheet (pdf, 122 KB)
- pASG-IBA43 data sheet (pdf, 122 KB)
- pASG-IBA44 data sheet (pdf, 127 KB)
- pASG-IBA45 data sheet (pdf, 124 KB)
- pASG-IBA62 data sheet (pdf, 126 KB)
- pASG-IBA63 data sheet (pdf, 116 KB)
- pASG-IBA64 data sheet (pdf, 124 KB)
- pASG-IBA65 data sheet (pdf, 120 KB)
- pASG-IBA102 data sheet (pdf, 129 KB)
- pASG-IBA103 data sheet (pdf, 126 KB)
- pASG-IBA104 data sheet (pdf, 134 KB)
- pASG-IBA105 data sheet (pdf, 134 KB)
- pASG-IBA123 data sheet (pdf, 229 KB)
- pASG-IBA143 data sheet (pdf, 133 KB)
- pASG-IBA144 data sheet (pdf, 134 KB)
- pASG-IBA145 data sheet (pdf, 133 KB)
- pASG-IBA162 data sheet (pdf, 132 KB)
- pASG-IBA164 data sheet (pdf, 133 KB)
- pASG-IBA167 data sheet (pdf, 125 KB)
- pASG-IBA168 data sheet (pdf, 136 KB)
pCSG-IBA Vectors (Mammalian episomal vectors)
- pCSG-IBAwt1 data sheet (pdf, 117 KB)
- pCSG-IBAwt2 data sheet (pdf, 126 KB)
- pCSG-IBA3 data sheet (pdf, 125 KB)
- pCSG-IBA5 data sheet (pdf, 117 KB)
- pCSG-IBA23 data sheet (pdf, 230 KB)
- pCSG-IBA25 data sheet (pdf, 228 KB)
- pCSG-IBA33 data sheet (pdf, 114 KB)
- pCSG-IBA35 data sheet (pdf, 115 KB)
- pCSG-IBA43 data sheet (pdf, 128 KB)
- pCSG-IBA45 data sheet (pdf, 131 KB)
- pCSG-IBA62 data sheet (pdf, 118 KB)
- pCSG-IBA63 data sheet (pdf, 122 KB)
- pCSG-IBA64 data sheet (pdf, 130 KB)
- pCSG-IBA65 data sheet (pdf, 124 KB)
- pCSG-IBA102 data sheet (pdf, 118 KB)
- pCSG-IBA103 data sheet (pdf, 117 KB)
- pCSG-IBA104 data sheet (pdf, 119 KB)
- pCSG-IBA105 data sheet (pdf, 137 KB)
- pCSG-IBA123 data sheet (pdf, 232 KB)
- pCSG-IBA142 data sheet (pdf, 130 KB)
- pCSG-IBA143 data sheet (pdf, 119 KB)
- pCSG-IBA144 data sheet (pdf, 137 KB)
- pCSG-IBA145 data sheet (pdf, 139 KB)
- pCSG-IBA162 data sheet (pdf, 122 KB)
- pCSG-IBA164 data sheet (pdf, 140 KB)
- pCSG-IBA167 data sheet (pdf, 147 KB)
- pCSG-IBA168 data sheet (pdf, 144 KB)
pESG-IBA Vectors (Mammalian cells with CMV promoter)
- pESG-IBAwt1 data sheet (pdf, 108 KB)
- pESG-IBAwt2 data sheet (pdf, 108 KB)
- pESG-IBA3 data sheet (pdf, 118 KB)
- pESG-IBA5 data sheet (pdf, 110 KB)
- pESG-IBA23 data sheet (pdf, 225 KB)
- pESG-IBA25 data sheet (pdf, 220 KB)
- pESG-IBA33 data sheet (pdf, 110 KB)
- pESG-IBA35 data sheet (pdf, 112 KB)
- pESG-IBA43 data sheet (pdf, 115 KB)
- pESG-IBA45 data sheet (pdf, 125 KB)
- pESG-IBA62 data sheet (pdf, 125 KB)
- pESG-IBA63 data sheet (pdf, 115 KB)
- pESG-IBA64 data sheet (pdf, 115 KB)
- pESG-IBA65 data sheet (pdf, 117 KB)
- pESG-IBA102 data sheet (pdf, 127 KB)
- pESG-IBA103 data sheet (pdf, 119 KB)
- pESG-IBA104 data sheet (pdf, 117 KB)
- pESG-IBA105 data sheet (pdf, 133 KB)
- pESG-IBA123 data sheet (pdf, 226 KB)
- pESG-IBA142 data sheet (pdf, 118 KB)
- pESG-IBA143 data sheet (pdf, 134 KB)
- pESG-IBA144 data sheet (pdf, 137 KB)
- pESG-IBA145 data sheet (pdf, 135 KB)
- pESG-IBA162 data sheet (pdf, 133 KB)
- pESG-IBA164 data sheet (pdf, 135 KB)
- pESG-IBA167 data sheet (pdf, 141 KB)
- pESG-IBA168 data sheet (pdf, 138 KB)
pLSG-IBA Vectors (Insect cells (baculovirus) with polyhedrin promoter
- pLSG-IBAwt1 data sheet (pdf, 113 KB)
- pLSG-IBAwt2 data sheet (pdf, 134 KB)
- pLSG-IBA3 data sheet (pdf, 135 KB)
- pLSG-IBA5 data sheet (pdf, 137 KB)
- pLSG-IBA23 data sheet (pdf, 240 KB)
- pLSG-IBA25 data sheet (pdf, 134 KB)
- pLSG-IBA33 data sheet (pdf, 131 KB)
- pLSG-IBA35 data sheet (pdf, 133 KB)
- pLSG-IBA43 data sheet (pdf, 137 KB)
- pLSG-IBA45 data sheet (pdf, 139 KB)
- pLSG-IBA62 data sheet (pdf, 139 KB)
- pLSG-IBA63 data sheet (pdf, 132 KB)
- pLSG-IBA64 data sheet (pdf, 140 KB)
- pLSG-IBA65 data sheet (pdf, 134 KB)
- pLSG-IBA102 data sheet (pdf, 133 KB)
- pLSG-IBA103 data sheet (pdf, 136 KB)
- pLSG-IBA104 data sheet (pdf, 132 KB)
- pLSG-IBA105 data sheet (pdf, 140 KB)
- pLSG-IBA123 data sheet (pdf, 231 KB)
- pLSG-IBA142 data sheet (pdf, 143 KB)
- pLSG-IBA143 data sheet (pdf, 148 KB)
- pLSG-IBA144 data sheet (pdf, 145 KB)
- pLSG-IBA145 data sheet (pdf, 142 KB)
- pLSG-IBA162 data sheet (pdf, 132 KB)
- pLSG-IBA164 data sheet (pdf, 149 KB)
- pLSG-IBA167 data sheet (pdf, 153 KB)
- pLSG-IBA168 data sheet (pdf, 132 KB)
pPSG-IBA Vectors (E. coli with T7 promoter)
- pPSG-IBAwt1 data sheet (pdf, 103 KB)
- pPSG-IBA3 data sheet (pdf, 110 KB)
- pPSG-IBA5 data sheet (pdf, 113 KB)
- pPSG-IBA23 data sheet (pdf, 120 KB)
- pPSG-IBA25 data sheet (pdf, 119 KB)
- pPSG-IBA33 data sheet (pdf, 111 KB)
- pPSG-IBA35 data sheet (pdf, 109 KB)
- pPSG-IBA43 data sheet (pdf, 115 KB)
- pPSG-IBA45 data sheet (pdf, 114 KB)
- pPSG-IBA62 data sheet (pdf, 116 KB)
- pPSG-IBA63 data sheet (pdf, 111 KB)
- pPSG-IBA64 data sheet (pdf, 116 KB)
- pPSG-IBA65 data sheet (pdf, 110 KB)
- pPSG-IBA103 data sheet (pdf, 119 KB)
- pPSG-IBA105 data sheet (pdf, 122 KB)
- pPSG-IBA123 data sheet (pdf, 121 KB)
- pPSG-IBA143 data sheet (pdf, 122 KB)
- pPSG-IBA145 data sheet (pdf, 124 KB)
- pPSG-IBA162 data sheet (pdf, 126 KB)
- pPSG-IBA164 data sheet (pdf, 126 KB)
- pPSG-IBA167 data sheet (pdf, 131 KB)
- pPSG-IBA168 data sheet (pdf, 129 KB)
pYSG-IBA Vectors (Yeast with CUP1 promoter)
- pYSG-IBAwt1 data sheet (pdf, 109 KB)
- pYSG-IBA3 data sheet (pdf, 115 KB)
- pYSG-IBA5 data sheet (pdf, 117 KB)
- pYSG-IBA23 data sheet (pdf, 117 KB)
- pYSG-IBA25 data sheet (pdf, 221 KB)
- pYSG-IBA33 data sheet (pdf, 115 KB)
- pYSG-IBA35 data sheet (pdf, 117 KB)
- pYSG-IBA43 data sheet (pdf, 125 KB)
- pYSG-IBA45 data sheet (pdf, 113 KB)
- pYSG-IBA62 data sheet (pdf, 120 KB)
- pYSG-IBA63 data sheet (pdf, 101 KB)
- pYSG-IBA64 data sheet (pdf, 122 KB)
- pYSG-IBA65 data sheet (pdf, 102 KB)
- pYSG-IBA103 data sheet (pdf, 127 KB)
- pYSG-IBA105 data sheet (pdf, 116 KB)
- pYSG-IBA123 data sheet (pdf, 227 KB)
- pYSG-IBA143 data sheet (pdf, 114 KB)
- pYSG-IBA145 data sheet (pdf, 132 KB)
- pYSG-IBA162 data sheet (pdf, 131 KB)
- pYSG-IBA164 data sheet (pdf, 122 KB)
- pYSG-IBA167 data sheet (pdf, 137 KB)
- pYSG-IBA168 data sheet (pdf, 134 KB)
StarGate Fusion Vectors
pNFuse-IBA Vectors
pCFuse-IBA Vector

Vector Sequences
Classic Vectors (txt):
pASK-IBA Vectors (E. coli with Tet promoter)
pPR-IBA Vectors (E. coli with T7 promoter)
pEXPR-IBA Vectors (mammalia with CMV promoter)
pKS ST Vectors (yeast with ADH2 promoter)

StarGate Vectors (txt):
StarGate ENTRY Vectors
StarGate Acceptor Vectors:
pASG-IBA Vectors
pCSG-IBA Vectors
pESG-IBA Vectors
pLSG-IBA Vectors
pPSG-IBA Vectors
pYSG-IBA Vectors
Fusion Cloning Vectors:
pNFuse-IBA Vectors
pCFuse-IBA Vector

StarGate Acceptor Vector List
Comprehensive list of StarGate Acceptor Vectors

Technical Information
Gene TAGnologies
Molecular weight and extinction coefficients of synthetic oligonucleotides
- Calculate the molecular weight of DNA as follows:
| Mol. wt = |
[(251 x nA) + (242 x nT) + (267 x nG) + (227 x nC) + (63 x n - 1) +
(23 x n - 1) + 2] |
nA = number of adenine bases in the DNA sequence and n = total number of bases.
(63 x n - 1) accounts for the molecular weight of the phosphate groups. For phosphorothioates this is (78 x n - 1)
(23 x n - 1) accounts for the sodium cations associated with the phosphate groups. If the DNA is an ammonium salt this is (17 x n - 1).
Example:
The 20mer d(AGCTCTGAACGTAGCTCTGA)
| Mol. wt = |
[(5 x 251) + (5 x 242) + (5 x 267) + (5 x 227) + (63 x 19) +
(23 x 19) + 2] = 6571 mg/mmol
|
- Calculation of millimolar extinction coefficient (E254):
E254 = [(8.8 x nT) + (7.3 x nC) + (11.7 x nG) + (15.4 x nA)] x 0.9*
For the 20mer d(AGCTCTGAACGTAGCTCTGA):
E254 = [(8.8 x 5) + (7.3 x 5) + (11.7 x 5) + (15.4 x 5)] x 0.9* = 194.4 mM-1cm-1
*Note that it is advisable to multiply the sum of the extinction coefficient of the individual bases by a factor of 0.9. This is because base stacking interactions in the single strand suppress the absorbance of DNA relative to the value calculated from the extinction coefficients of the individual nucleosides. This effect is greater for a duplex and the multiplication factor for a selfcomplementary sequence is c. 0.8. These figures are estimates for typical DNA sequences.
- To convert OD units to milligrams
From the above calculations, 6.6 mg of the oligonucleotide
d (AGCTCTGAACGTAG CTCTGA) dissolved in 1 ml will have an absorbance of approximately 194.4 OD units at 254 nm.
6.6 mg = 194.4 OD units. Therfore, 1 mg = 29 OD
| Protein/DNA conversion
1kb of DNA encodes 333 amino acids = 3.7 x 104 DA |
Molecular conversion for protein |
| Protein |
DNA |
100 pmol |
µg |
| 10,000 Da |
270.0 bp |
10,000 Da protein |
1 |
| 30,000 Da |
810.0 bp |
30,000 Da protein |
3 |
| 100,000 Da |
2.7 kb |
100,000 Da protein |
10 |
Melting temperature of duplex DNA and oligonucleotides
- For duplex oligonucleotide shorter than 25 bp
Tm = 2(A+T) + 4(C+G)
A, T, C, G - number of respective bases
- For duplex DNA longer than 25 bp
Tm = 81.5°C + (16.6log10[Na+])+0.41 x (G+C)%-600/n
n=length of oligonucleotide
The genetic code

Nucleotide ambiguity code
| Code |
Represents |
Complement |
| A |
A |
T |
| C |
C |
G |
| G |
G |
C |
| T |
T |
A |
| M |
A or C |
K |
| R |
A or G |
Y |
| W |
A or T |
W |
| S |
C or G |
S |
| Y |
C or T |
R |
| K |
G or T |
M |
| V |
A or C or G |
B |
| H |
A or C or T |
D |
| D |
A or G or T |
H |
| B |
C or G or T |
V |
| X/N |
A or C or G or T |
X/N |

|
not A, C, G or T |
- |

Protein TAGnologies
Converting from linear flow (cm/hour) to volumetric flow rates (ml/min) and vice versa
It is convenient when comparing results for columns of different sizes to express flow as linear flow (cm/hour). However, flow is usually measured in volumetric flow rate (ml/min). To convert between linear and volumetric flow rate use one of the formulae below.
From linear flow rate (cm/hour) to volumetric flow rate (ml/min)
| Volumetric flow rate (ml/min) = |
Linear flow rate (cm/h) |
x column cross sectional area (cm2) |
| 60 |
where
LFR = linear flow rate in cm/h
d = inner diameter of the column in cm
Example:
What is the recommended volumetric flow rate in a Ready-to-use Strep-Tactin POROS column (i.d. 0.46 cm) when the recommended linear flow rate is 700 cm/hour?
LFR = 700 cm/h
d = 0.46 cm
| Volumetric flow rate (ml/min) = |
700 |
x |
p x 0.462 |
= 1.94 ml/min |
| 60 |
4 |
From volumetric flow rate (ml/min) to linear flow rate (cm/hour)
| Linear flow rate (cm/h) = |
Volumetic flow rate (ml/min) x 60 |
| column cross sectional area (cm2) |
|
where
VFR = volumetric flow rate in cm/h
d = inner diameter of the column in cm
Example:
What is the recommended linear flow rate in a Ready-to-use MacroPrep Cartridge (i.d. 0.59 cm) when the recommended volumetric flow rate is 1.5 ml/min?
VFR = 1.5 ml/min
d = 0.59 cm
| Linear flow rate (cm/h) = |
1.5 x 60 x 4 |
= 329 cm/h |
| p x 0.592 |
 |